Yum, spotting regulations...

regul@tion spotting

documentation

Alteration chr4:89442139T>G

Likely effect

non-functional region (much evidence)


Model: extratranscriptic, Score: 11.16

direct link to this output
     
Summary
  • Histone modifications in 3+ cell lines
  • might affect genomic interactions
analysed issue analysis result
alteration (phys. location) chr4:89442139T>G   IGV
alteration type SNV
alteration region extratranscriptic
known variant Reference ID: rs572557152
databasehomozygous (G/G)heterozygousallele carriers
1000G 011
ExAC---

promoters
RegulationSpotter - near TSSs of Ensembl transcripts
positionevidencegenetranscript
4: 89441699-89442249 no histone marksHERC3ENST00000601319
enhancers none found
epigenetic marks (RegulationSpotter) no regulatory regions annotated
histone modifications
genomic
feature
blood artery vein immune ESC iPSC endocrin neural conn.tiss. bone muscle skin brain eye lung heart breast GIT liver pancreas spleen kidney ovary placenta amnion cervix testis
H3K36me3erythroblast (CB)
GM12878
K562
Monocytes-CD14+ (PB) Roadmap
MSC (VB)
naive B cell (To)
naive B cell (VB)
neutrophil (CB)
neutrophil (VB)
neutrophil myelocyte (BM)
EPC (VB)
HUVEC
HUVEC prol (CB)
B cells (PB) Roadmap
CD14+CD16- monocyte (CB)
CD14+CD16- monocyte (VB)
CD38- naive B cell (CB)
CD4+ ab T cell (VB)
CD8+ ab T cell (CB)
CM CD4+ ab T cell (VB)
DND-41
EM CD8+ ab T cell (VB)
Fetal Thymus
M0 macrophage (CB)
M0 macrophage (VB)
M1 macrophage (CB)
M1 macrophage (VB)
M2 macrophage (CB)
M2 macrophage (VB)
Monocytes-CD14+
Natural Killer cells (PB)
iPS-20b Osteobl Fetal Muscle Leg
HSMM
HSMMtube
NHEK NH-A A549 HMEC Fetal Intestine Large HepG2 Placenta
H3K4me1GM12878 DND-41
H3K79me2GM12878
K562
HSMM
HSMMtube
H4K20me1HeLa-S3
show features in Ensembl  explain
polymerase none found
open chromatin none found
TFBS (confirmed) none found
TFBS (by motif) no TFBS-like motif annotated
genomic interactions HiC interactions
associated gene(s) interacting element harbouring variant... blood vein immune ESC iPSC endocrin neural conn.tiss. bone muscle skin brain breast GIT liver pancreas kidney placenta cervix testis lung
gene symbolEnsembl IDshow transcripts
HERC3 ENSG00000138641
processed transcript:
ENST00000601319
promoterGM12878 HUVEC CD4 Naive
CD4 T
IPS6.9 Foreskin fibroblast
IMR90
NHLF
HSMM Foreskin keratinocyte
NHEK
HMEC
ENSG00000252322distant element, interacts w/ promoterGM12878 HUVEC
FAM13A ENSG00000138640
retained intron:
ENST00000511623
distant element, interacts w/ promoterHSMM
HERC3 ENSG00000138641distant element, interacts w/ promoterGM12878 HUVEC IPS6.9 IMR90 NHEK
LOC100129137 ENSG00000249755
processed pseudogene:
ENST00000503756
distant element, interacts w/ promoterGM12878
PIGY ENSG00000255072
protein-coding:
ENST00000527353
distant element, interacts w/ promoterGM12878 HUVEC CD4 Naive
CD4 T
IPS6.9 Foreskin fibroblast
IMR90
NHLF
HSMM Foreskin keratinocyte
NHEK
HMEC

show interactions as plot
phyloP / phastCons
PhyloPPhastCons
(flanking)0.0920
-0.7570
(flanking)-3.4090
explain score(s) and/or inspect your position(s) in in UCSC Genome Browser
CADD (scaled) 7.02   (please see documentation for details)
chromosome 4
strand 1
original chrDNA sequence snippet CCAAACAAACAAACGACTACTGCAAACTGGTTTATTTTTTA
altered chrDNA sequence snippet CCAAACAAACAAACGACTACGGCAAACTGGTTTATTTTTTA
speed 0.44 s

All positions are in basepairs (bp) if not explicitly stated differently.
Abbreviations: aa: amino acid; CDS: coding sequence; mu: mutated; NMD: nonsense-mediated mRNA decay; nt: nucleotide; wt: wildtype; TGP: 1000 Genomes Project

show score composition

mod_perl version: CGI