MutationTaster - study a chromosomal position

NEVER press reload or F5 - unless you want to start from the very beginning.
input seems to be ok - now mapping the variant to the different transcripts...
Querying Taster for transcript #2: ENST00000607273
MT speed 0 s - this script 3.209898 s

Results


genesymbolpredpmodelpred_problemf_splicef_known_DMf_pot_DMAA_changesalt_typesnp_idfeatures_at_a_glancefile
PRIM2disease causing0.999709699426547simple_aaen/a77436138show file

Taster files

Yum, tasty mutations...

mutation t@sting

documentation

Alteration 6:57398226T>G_1_ENST00000607273

Prediction

disease causing

Model: simple_aae, prob: 0.999709699426547      (explain)
Summary
  • amino acid sequence changed
  • heterozygous in TGP or ExAC
hyperlink
analysed issue analysis result
name of alteration 6:57398226T>G_1_ENST00000607273
alteration (phys. location) chr6:57398226T>G show variant in all transcripts   IGV
HGNC symbol PRIM2
ExAC LOF metrics LOF: 0.00, misssense: -0.86, synonymous: -0.47
Ensembl transcript ID ENST00000607273
Genbank transcript ID NM_000947
UniProt peptide N/A
alteration type single base exchange
alteration region CDS
DNA changes c.929T>G
g.218624T>G
AA changes V310G Score: 109
explain score(s)
frameshift no
length of protein normal
known variant Reference ID: rs77436138
databasehomozygous (G/G)heterozygousallele carriers
1000G---
ExAC13276732768
regulatory features
nameclass
H3K36me3 Histone Histone 3 Lysine 36 Tri-Methylation
multicell regulatory features N/A
external features from FANTOM5 and/or VISTA N/A
miRNA binding site(s) N/A
phyloP / phastCons
PhyloPPhastCons
(flanking)6.2351
4.5981
(flanking)0.0950.988
explain score(s) and/or inspect your position(s) in in UCSC Genome Browser
splice sites no abrogation of potential splice sites
distance from splice site N/A
Kozak consensus sequence altered? no
conservation
protein level for non-synonymous changes
speciesmatchgeneaaalignment
Human      310HHLCHGGRMQYVLFLKGIGLTLEQ
mutated  not conserved    310LCHGGRMQYGLFLKGIGLTLE
Ptroglodytes  no homologue    
Mmulatta  not conserved  ENSMMUG00000001150  310LRHGGRMQYGLFLKGIGLTLE
Fcatus  not conserved  ENSFCAG00000029312  312HHLRHGGRMQYGLFLKGIGLTLE
Mmusculus  not conserved  ENSMUSG00000026134  310LRHGGRMQYGLFLKGIGLTLE
Ggallus  not conserved  ENSGALG00000016278  310HLRHGGRMQYGLFLKGIGLTLE
Trubripes  no homologue    
Drerio  not conserved  ENSDARG00000052721  315HHLRHGGRMQYGLFLKGIGLTLE
Dmelanogaster  not conserved  FBgn0259676  322HHIKHSGRMQYGLFLKGIGVALE
Celegans  not conserved  WBGene00004181  329HHLKYGARRQYGL
Xtropicalis  not conserved  ENSXETG00000004450  318HHLRHGGRMQYGLFLKGIGLTLE
protein features N/A
AA sequence altered yes
position of stopcodon in wt / mu CDS 1041 / 1041
position (AA) of stopcodon in wt / mu AA sequence 347 / 347
position of stopcodon in wt / mu cDNA 1128 / 1128
poly(A) signal N/A
position of start ATG in wt / mu cDNA 88 / 88
chromosome 6
strand 1
last intron/exon boundary 1386
theoretical NMD boundary in CDS 1248
length of CDS 1041
coding sequence (CDS) position 929
cDNA position
(for ins/del: last normal base / first normal base)
1016
gDNA position
(for ins/del: last normal base / first normal base)
218624
chromosomal position
(for ins/del: last normal base / first normal base)
57398226
original gDNA sequence snippet TGGAGGCCGAATGCAGTATGTCCTATTTCTGAAGGGCATTG
altered gDNA sequence snippet TGGAGGCCGAATGCAGTATGGCCTATTTCTGAAGGGCATTG
original cDNA sequence snippet TGGAGGCCGAATGCAGTATGTCCTATTTCTGAAGGGCATTG
altered cDNA sequence snippet TGGAGGCCGAATGCAGTATGGCCTATTTCTGAAGGGCATTG
wildtype AA sequence MEFSGRKWRK LRLAGDQRNA SYPHCLQFYL QPPSENISLI EFENLAIDRV KLLKSVENLG
VSYVKGTEQY QSKLESELRK LKFSYRENLE DEYEPRRRDH ISHFILRLAY CQSEELRRWF
IQQEMDLLRF RFSILPKDKI QDFLKDSQLQ FEAISDEEKT LREQEIVASS PSLSGLKLGF
ESIYKIPFAD ALDLFRGRKV YLEDGFAYVP LKDIVAIILN EFRAKLSKAL ALTARSLPAV
QSDERLQPLL NHLSHSYTSQ DYSTQGNVGK ISLDQIDLLS TKSFPLYMHQ LHKALRENHH
LCHGGRMQYV LFLKGIGLTL EQTLQFWKQE FIKGKMDPDK FDKGYS*
mutated AA sequence MEFSGRKWRK LRLAGDQRNA SYPHCLQFYL QPPSENISLI EFENLAIDRV KLLKSVENLG
VSYVKGTEQY QSKLESELRK LKFSYRENLE DEYEPRRRDH ISHFILRLAY CQSEELRRWF
IQQEMDLLRF RFSILPKDKI QDFLKDSQLQ FEAISDEEKT LREQEIVASS PSLSGLKLGF
ESIYKIPFAD ALDLFRGRKV YLEDGFAYVP LKDIVAIILN EFRAKLSKAL ALTARSLPAV
QSDERLQPLL NHLSHSYTSQ DYSTQGNVGK ISLDQIDLLS TKSFPLYMHQ LHKALRENHH
LCHGGRMQYG LFLKGIGLTL EQTLQFWKQE FIKGKMDPDK FDKGYS*
version genome build 37 / Ensembl release 85
speed 0.25 s

for research use only

All positions are in basepairs (bp) if not explicitly stated differently.
AA/aa: amino acid; CDS: coding sequence; mu: mutated; NMD: nonsense-mediated mRNA decay; nt: nucleotide; wt: wildtype; TGP: 1000 Genomes Project
back to results table

Problems