MutationTaster - study a chromosomal position

NEVER press reload or F5 - unless you want to start from the very beginning.
input seems to be ok - now mapping the variant to the different transcripts...
Querying Taster for transcript #2: ENST00000607273
MT speed 0 s - this script 3.424287 s

Results


genesymbolpredpmodelpred_problemf_splicef_known_DMf_pot_DMAA_changesalt_typesnp_idfeatures_at_a_glancefile
PRIM2disease causing0.996194374753508simple_aaen/a62398997show file

Taster files

Yum, tasty mutations...

mutation t@sting

documentation

Alteration 6:57398201T>C_1_ENST00000607273

Prediction

disease causing

Model: simple_aae, prob: 0.996194374753508      (explain)
Summary
  • amino acid sequence changed
  • heterozygous in TGP or ExAC
hyperlink
analysed issue analysis result
name of alteration 6:57398201T>C_1_ENST00000607273
alteration (phys. location) chr6:57398201T>C show variant in all transcripts   IGV
HGNC symbol PRIM2
ExAC LOF metrics LOF: 0.00, misssense: -0.86, synonymous: -0.47
Ensembl transcript ID ENST00000607273
Genbank transcript ID NM_000947
UniProt peptide N/A
alteration type single base exchange
alteration region CDS
DNA changes c.904T>C
g.218599T>C
AA changes C302R Score: 180
explain score(s)
frameshift no
length of protein normal
known variant Reference ID: rs62398997
databasehomozygous (C/C)heterozygousallele carriers
1000G---
ExAC83276732775
regulatory features
nameclass
H3K36me3 Histone Histone 3 Lysine 36 Tri-Methylation
multicell regulatory features N/A
external features from FANTOM5 and/or VISTA N/A
miRNA binding site(s) N/A
phyloP / phastCons
PhyloPPhastCons
(flanking)-0.1810.967
2.7221
(flanking)6.2351
explain score(s) and/or inspect your position(s) in in UCSC Genome Browser
splice sites no abrogation of potential splice sites
distance from splice site N/A
Kozak consensus sequence altered? no
conservation
protein level for non-synonymous changes
speciesmatchgeneaaalignment
Human      302LHKALRENHHLCHGGRMQYVLFLK
mutated  not conserved    302LRHGGRMQYVLFL
Ptroglodytes  no homologue    
Mmulatta  not conserved  ENSMMUG00000001150  302LRHGGRMQYGLFL
Fcatus  not conserved  ENSFCAG00000029312  304HHLRHGGRMQYGLFL
Mmusculus  not conserved  ENSMUSG00000026134  302LRHGGRMQYGLFL
Ggallus  not conserved  ENSGALG00000016278  302HLRHGGRMQYGLFL
Trubripes  no homologue    
Drerio  not conserved  ENSDARG00000052721  307KALRENHHLRHGGRMQYGLFL
Dmelanogaster  not conserved  FBgn0259676  314CHEHIRANHHIKHSGRMQYGL
Celegans  not conserved  WBGene00004181  321MHNHLRVNHHLKYGARRQYGL
Xtropicalis  not conserved  ENSXETG00000004450  310HHLRHGGRMQYGLFL
protein features N/A
AA sequence altered yes
position of stopcodon in wt / mu CDS 1041 / 1041
position (AA) of stopcodon in wt / mu AA sequence 347 / 347
position of stopcodon in wt / mu cDNA 1128 / 1128
poly(A) signal N/A
position of start ATG in wt / mu cDNA 88 / 88
chromosome 6
strand 1
last intron/exon boundary 1386
theoretical NMD boundary in CDS 1248
length of CDS 1041
coding sequence (CDS) position 904
cDNA position
(for ins/del: last normal base / first normal base)
991
gDNA position
(for ins/del: last normal base / first normal base)
218599
chromosomal position
(for ins/del: last normal base / first normal base)
57398201
original gDNA sequence snippet TGCGGGAAAATCACCATCTTTGTCATGGAGGCCGAATGCAG
altered gDNA sequence snippet TGCGGGAAAATCACCATCTTCGTCATGGAGGCCGAATGCAG
original cDNA sequence snippet TGCGGGAAAATCACCATCTTTGTCATGGAGGCCGAATGCAG
altered cDNA sequence snippet TGCGGGAAAATCACCATCTTCGTCATGGAGGCCGAATGCAG
wildtype AA sequence MEFSGRKWRK LRLAGDQRNA SYPHCLQFYL QPPSENISLI EFENLAIDRV KLLKSVENLG
VSYVKGTEQY QSKLESELRK LKFSYRENLE DEYEPRRRDH ISHFILRLAY CQSEELRRWF
IQQEMDLLRF RFSILPKDKI QDFLKDSQLQ FEAISDEEKT LREQEIVASS PSLSGLKLGF
ESIYKIPFAD ALDLFRGRKV YLEDGFAYVP LKDIVAIILN EFRAKLSKAL ALTARSLPAV
QSDERLQPLL NHLSHSYTSQ DYSTQGNVGK ISLDQIDLLS TKSFPLYMHQ LHKALRENHH
LCHGGRMQYV LFLKGIGLTL EQTLQFWKQE FIKGKMDPDK FDKGYS*
mutated AA sequence MEFSGRKWRK LRLAGDQRNA SYPHCLQFYL QPPSENISLI EFENLAIDRV KLLKSVENLG
VSYVKGTEQY QSKLESELRK LKFSYRENLE DEYEPRRRDH ISHFILRLAY CQSEELRRWF
IQQEMDLLRF RFSILPKDKI QDFLKDSQLQ FEAISDEEKT LREQEIVASS PSLSGLKLGF
ESIYKIPFAD ALDLFRGRKV YLEDGFAYVP LKDIVAIILN EFRAKLSKAL ALTARSLPAV
QSDERLQPLL NHLSHSYTSQ DYSTQGNVGK ISLDQIDLLS TKSFPLYMHQ LHKALRENHH
LRHGGRMQYV LFLKGIGLTL EQTLQFWKQE FIKGKMDPDK FDKGYS*
version genome build 37 / Ensembl release 85
speed 0.25 s

for research use only

All positions are in basepairs (bp) if not explicitly stated differently.
AA/aa: amino acid; CDS: coding sequence; mu: mutated; NMD: nonsense-mediated mRNA decay; nt: nucleotide; wt: wildtype; TGP: 1000 Genomes Project
back to results table

Problems