MutationTaster - study a chromosomal position

NEVER press reload or F5 - unless you want to start from the very beginning.
input seems to be ok - now mapping the variant to the different transcripts...
Querying Taster for transcript #2: ENST00000468148
Querying Taster for transcript #3: ENST00000317483
MT speed 0 s - this script 3.771817 s

Results


genesymbolpredpmodelpred_problemf_splicef_known_DMf_pot_DMAA_changesalt_typesnp_idfeatures_at_a_glancefile
RAB23disease causing (ClinVar)1simple_aae0n/a1060505026show file
RAB23disease causing (ClinVar)1simple_aae0n/a1060505026show file

Taster files

Yum, tasty mutations...

mutation t@sting

documentation

Alteration 6:57059568C>G_1_ENST00000468148

Prediction

disease causing

Model: simple_aae, prob: 1 (classification due to ClinVar, real probability is shown anyway)      (explain)
Summary
  • amino acid sequence changed
  • known disease mutation at this position (HGMD CS1410189)
  • known disease mutation: ClinVar ID 417740 (pathogenic)
hyperlink
analysed issue analysis result
name of alteration 6:57059568C>G_1_ENST00000468148
alteration (phys. location) chr6:57059568C>G show variant in all transcripts   IGV
HGNC symbol RAB23
ExAC LOF metrics LOF: 0.04, misssense: 0.06, synonymous: -1.18
Ensembl transcript ID ENST00000468148
Genbank transcript ID NM_183227
UniProt peptide Q9ULC3
alteration type single base exchange
alteration region CDS
DNA changes c.481G>C
g.27511G>C
AA changes V161L Score: 32
explain score(s)
frameshift no
length of protein normal
known variant Reference ID: rs1060505026
Allele 'G' was not found in ExAC or 1000G.
known disease mutation: ClinVar variation ID 417740 (pathogenic for Carpenter syndrome)

known disease mutation at this position, please check HGMD for details (HGMD ID CS1410189)
regulatory features N/A
multicell regulatory features N/A
external features from FANTOM5 and/or VISTA N/A
miRNA binding site(s) N/A
phyloP / phastCons
PhyloPPhastCons
(flanking)5.2921
5.2921
(flanking)1.9041
explain score(s) and/or inspect your position(s) in in UCSC Genome Browser
splice sites no abrogation of potential splice sites
distance from splice site 1
Kozak consensus sequence altered? no
conservation
protein level for non-synonymous changes
speciesmatchgeneaaalignment
Human      161TSVKEDLNVNEVFKYLAEKYLQKL
mutated  all conserved    161TSVKEDLNVNELFKYLAEKYLQK
Ptroglodytes  all identical  ENSPTRG00000018308  161TSVKEDLNVNEVFKYLAEKYLQK
Mmulatta  all identical  ENSMMUG00000018003  161TSVKEDLNVNEVFKYLAEKYLQK
Fcatus  all identical  ENSFCAG00000001010  161APPPPSLSLSLLVFKYLAEKYLQK
Mmusculus  all identical  ENSMUSG00000004768  161TSVKEDLNVSEVFKYLAEKHLQK
Ggallus  all identical  ENSGALG00000016279  161ASVKEDLNITEVFKYLADKYLQR
Trubripes  all identical  ENSTRUG00000015697  161ASVKEDLNVNEVFKCLADKYLQR
Drerio  all identical  ENSDARG00000004151  161TSVKEDLNVNEVFKYLADKYLQR
Dmelanogaster  all identical  FBgn0037364  189TSVKEDINVASVFRYLATKCHQL
Celegans  no homologue    
Xtropicalis  all identical  ENSXETG00000004449  161TSVKEDLNVTEVFKYLADKYLQR
protein features no protein features affected
AA sequence altered yes
position of stopcodon in wt / mu CDS 714 / 714
position (AA) of stopcodon in wt / mu AA sequence 238 / 238
position of stopcodon in wt / mu cDNA 868 / 868
poly(A) signal N/A
position of start ATG in wt / mu cDNA 155 / 155
chromosome 6
strand -1
last intron/exon boundary 728
theoretical NMD boundary in CDS 523
length of CDS 714
coding sequence (CDS) position 481
cDNA position
(for ins/del: last normal base / first normal base)
635
gDNA position
(for ins/del: last normal base / first normal base)
27511
chromosomal position
(for ins/del: last normal base / first normal base)
57059568
original gDNA sequence snippet AAGATCTAAATGTGAATGAAGGTAAATTACCTTTAAAGGAT
altered gDNA sequence snippet AAGATCTAAATGTGAATGAACGTAAATTACCTTTAAAGGAT
original cDNA sequence snippet AAGATCTAAATGTGAATGAAGTTTTTAAGTATTTGGCTGAA
altered cDNA sequence snippet AAGATCTAAATGTGAATGAACTTTTTAAGTATTTGGCTGAA
wildtype AA sequence MLEEDMEVAI KMVVVGNGAV GKSSMIQRYC KGIFTKDYKK TIGVDFLERQ IQVNDEDVRL
MLWDTAGQEE FDAITKAYYR GAQACVLVFS TTDRESFEAV SSWREKVVAE VGDIPTVLVQ
NKIDLLDDSC IKNEEAEALA KRLKLRFYRT SVKEDLNVNE VFKYLAEKYL QKLKQQIAED
PELTHSSSNK IGVFNTSGGS HSGQNSGTLN GGDVINLRPN KQRTKKNRNP FSSCSIP*
mutated AA sequence MLEEDMEVAI KMVVVGNGAV GKSSMIQRYC KGIFTKDYKK TIGVDFLERQ IQVNDEDVRL
MLWDTAGQEE FDAITKAYYR GAQACVLVFS TTDRESFEAV SSWREKVVAE VGDIPTVLVQ
NKIDLLDDSC IKNEEAEALA KRLKLRFYRT SVKEDLNVNE LFKYLAEKYL QKLKQQIAED
PELTHSSSNK IGVFNTSGGS HSGQNSGTLN GGDVINLRPN KQRTKKNRNP FSSCSIP*
version genome build 37 / Ensembl release 85
speed 0.29 s

for research use only

All positions are in basepairs (bp) if not explicitly stated differently.
AA/aa: amino acid; CDS: coding sequence; mu: mutated; NMD: nonsense-mediated mRNA decay; nt: nucleotide; wt: wildtype; TGP: 1000 Genomes Project
back to results table
Yum, tasty mutations...

mutation t@sting

documentation

Alteration 6:57059568C>G_2_ENST00000317483

Prediction

disease causing

Model: simple_aae, prob: 1 (classification due to ClinVar, real probability is shown anyway)      (explain)
Summary
  • amino acid sequence changed
  • known disease mutation at this position (HGMD CS1410189)
  • known disease mutation: ClinVar ID 417740 (pathogenic)
hyperlink
analysed issue analysis result
name of alteration 6:57059568C>G_2_ENST00000317483
alteration (phys. location) chr6:57059568C>G show variant in all transcripts   IGV
HGNC symbol RAB23
ExAC LOF metrics LOF: 0.04, misssense: 0.06, synonymous: -1.18
Ensembl transcript ID ENST00000317483
Genbank transcript ID NM_001278667, NM_016277
UniProt peptide Q9ULC3
alteration type single base exchange
alteration region CDS
DNA changes c.481G>C
g.27511G>C
AA changes V161L Score: 32
explain score(s)
frameshift no
length of protein normal
known variant Reference ID: rs1060505026
Allele 'G' was not found in ExAC or 1000G.
known disease mutation: ClinVar variation ID 417740 (pathogenic for Carpenter syndrome)

known disease mutation at this position, please check HGMD for details (HGMD ID CS1410189)
regulatory features N/A
multicell regulatory features N/A
external features from FANTOM5 and/or VISTA N/A
miRNA binding site(s) N/A
phyloP / phastCons
PhyloPPhastCons
(flanking)5.2921
5.2921
(flanking)1.9041
explain score(s) and/or inspect your position(s) in in UCSC Genome Browser
splice sites no abrogation of potential splice sites
distance from splice site 1
Kozak consensus sequence altered? no
conservation
protein level for non-synonymous changes
speciesmatchgeneaaalignment
Human      161TSVKEDLNVNEVFKYLAEKYLQKL
mutated  all conserved    161TSVKEDLNVNELFKYLAEKYLQK
Ptroglodytes  all identical  ENSPTRG00000018308  161TSVKEDLNVNEVFKYLAEKYLQK
Mmulatta  all identical  ENSMMUG00000018003  161TSVKEDLNVNEVFKYLAEKYLQK
Fcatus  all identical  ENSFCAG00000001010  161APPPPSLSLSLLVFKYLAEKYLQK
Mmusculus  all identical  ENSMUSG00000004768  161TSVKEDLNVSEVFKYLAEKHLQK
Ggallus  all identical  ENSGALG00000016279  161ASVKEDLNITEVFKYLADKYLQR
Trubripes  all identical  ENSTRUG00000015697  161ASVKEDLNVNEVFKCLADKYLQR
Drerio  all identical  ENSDARG00000004151  161TSVKEDLNVNEVFKYLADKYLQR
Dmelanogaster  all identical  FBgn0037364  189TSVKEDINVASVFRYLATKCHQL
Celegans  no homologue    
Xtropicalis  all identical  ENSXETG00000004449  161TSVKEDLNVTEVFKYLADKYLQR
protein features no protein features affected
AA sequence altered yes
position of stopcodon in wt / mu CDS 714 / 714
position (AA) of stopcodon in wt / mu AA sequence 238 / 238
position of stopcodon in wt / mu cDNA 1334 / 1334
poly(A) signal N/A
position of start ATG in wt / mu cDNA 621 / 621
chromosome 6
strand -1
last intron/exon boundary 1194
theoretical NMD boundary in CDS 523
length of CDS 714
coding sequence (CDS) position 481
cDNA position
(for ins/del: last normal base / first normal base)
1101
gDNA position
(for ins/del: last normal base / first normal base)
27511
chromosomal position
(for ins/del: last normal base / first normal base)
57059568
original gDNA sequence snippet AAGATCTAAATGTGAATGAAGGTAAATTACCTTTAAAGGAT
altered gDNA sequence snippet AAGATCTAAATGTGAATGAACGTAAATTACCTTTAAAGGAT
original cDNA sequence snippet AAGATCTAAATGTGAATGAAGTTTTTAAGTATTTGGCTGAA
altered cDNA sequence snippet AAGATCTAAATGTGAATGAACTTTTTAAGTATTTGGCTGAA
wildtype AA sequence MLEEDMEVAI KMVVVGNGAV GKSSMIQRYC KGIFTKDYKK TIGVDFLERQ IQVNDEDVRL
MLWDTAGQEE FDAITKAYYR GAQACVLVFS TTDRESFEAV SSWREKVVAE VGDIPTVLVQ
NKIDLLDDSC IKNEEAEALA KRLKLRFYRT SVKEDLNVNE VFKYLAEKYL QKLKQQIAED
PELTHSSSNK IGVFNTSGGS HSGQNSGTLN GGDVINLRPN KQRTKKNRNP FSSCSIP*
mutated AA sequence MLEEDMEVAI KMVVVGNGAV GKSSMIQRYC KGIFTKDYKK TIGVDFLERQ IQVNDEDVRL
MLWDTAGQEE FDAITKAYYR GAQACVLVFS TTDRESFEAV SSWREKVVAE VGDIPTVLVQ
NKIDLLDDSC IKNEEAEALA KRLKLRFYRT SVKEDLNVNE LFKYLAEKYL QKLKQQIAED
PELTHSSSNK IGVFNTSGGS HSGQNSGTLN GGDVINLRPN KQRTKKNRNP FSSCSIP*
version genome build 37 / Ensembl release 85
speed 0.27 s

for research use only

All positions are in basepairs (bp) if not explicitly stated differently.
AA/aa: amino acid; CDS: coding sequence; mu: mutated; NMD: nonsense-mediated mRNA decay; nt: nucleotide; wt: wildtype; TGP: 1000 Genomes Project
back to results table

Problems