MutationTaster - study a chromosomal position

NEVER press reload or F5 - unless you want to start from the very beginning.
input seems to be ok - now mapping the variant to the different transcripts...
Querying Taster for transcript #2: ENST00000370888
MT speed 0 s - this script 3.365476 s

Results


genesymbolpredpmodelpred_problemf_splicef_known_DMf_pot_DMAA_changesalt_typesnp_idfeatures_at_a_glancefile
LRRC1disease causing0.999999998952445simple_aae1n/a201915048show file

Taster files

Yum, tasty mutations...

mutation t@sting

documentation

Alteration 6:53778661T>G_1_ENST00000370888

Prediction

disease causing

Model: simple_aae, prob: 0.999999998952445      (explain)
Summary
  • amino acid sequence changed
  • heterozygous in TGP or ExAC
  • protein features (might be) affected
hyperlink
analysed issue analysis result
name of alteration 6:53778661T>G_1_ENST00000370888
alteration (phys. location) chr6:53778661T>G show variant in all transcripts   IGV
HGNC symbol LRRC1
ExAC LOF metrics LOF: 0.57, misssense: 1.15, synonymous: -0.35
Ensembl transcript ID ENST00000370888
Genbank transcript ID NM_018214
UniProt peptide Q9BTT6
alteration type single base exchange
alteration region CDS
DNA changes c.1000T>G
g.119367T>G
AA changes C334G Score: 159
explain score(s)
frameshift no
length of protein normal
known variant Reference ID: rs201915048
databasehomozygous (G/G)heterozygousallele carriers
1000G---
ExAC0554554
regulatory features
nameclass
H3K36me3 Histone Histone 3 Lysine 36 Tri-Methylation
multicell regulatory features N/A
external features from FANTOM5 and/or VISTA N/A
miRNA binding site(s) N/A
phyloP / phastCons
PhyloPPhastCons
(flanking)-0.8840.564
4.230.998
(flanking)5.1011
explain score(s) and/or inspect your position(s) in in UCSC Genome Browser
splice sites no abrogation of potential splice sites
distance from splice site 10
Kozak consensus sequence altered? no
conservation
protein level for non-synonymous changes
speciesmatchgeneaaalignment
Human      334KLVSLPKEIGGCCSLTVFCVRDNR
mutated  not conserved    334KLVSLPKEIGGGCSLTVFCVRDN
Ptroglodytes  all identical  ENSPTRG00000018293  334KLVSLPKEIGGCCSLTVFCVRDN
Mmulatta  all identical  ENSMMUG00000011049  334KLVSLPKEIGGCCSLTVFCVRDN
Fcatus  all identical  ENSFCAG00000031982  298KLVSLPKEIGGCCSLTVFCVRDN
Mmusculus  all identical  ENSMUSG00000032352  334KLVSLPKEIGGCCSLTMFCIRDN
Ggallus  all identical  ENSGALG00000016304  282KLTSLPKEIGGCCSLNVFSVRDN
Trubripes  all identical  ENSTRUG00000015250  334QLTSLPKEIGGCQALNVFCVREN
Drerio  no homologue    
Dmelanogaster  all identical  FBgn0263289  335ALEYLPLEIGQCANLGVLSLRDN
Celegans  all identical  WBGene00002632  334NLSDIPDTIGNCKSLTVLSLRQN
Xtropicalis  all identical  ENSXETG00000001618  334KLMSLPKEIGGCCGLNVFCVREN
protein features
start (aa)end (aa)featuredetails 
311334REPEATLRR 14.lost
AA sequence altered yes
position of stopcodon in wt / mu CDS 1575 / 1575
position (AA) of stopcodon in wt / mu AA sequence 525 / 525
position of stopcodon in wt / mu cDNA 1852 / 1852
poly(A) signal N/A
position of start ATG in wt / mu cDNA 278 / 278
chromosome 6
strand 1
last intron/exon boundary 1693
theoretical NMD boundary in CDS 1365
length of CDS 1575
coding sequence (CDS) position 1000
cDNA position
(for ins/del: last normal base / first normal base)
1277
gDNA position
(for ins/del: last normal base / first normal base)
119367
chromosomal position
(for ins/del: last normal base / first normal base)
53778661
original gDNA sequence snippet TCTCACCATAGATCGGCGGGTGCTGCAGCCTCACTGTGTTC
altered gDNA sequence snippet TCTCACCATAGATCGGCGGGGGCTGCAGCCTCACTGTGTTC
original cDNA sequence snippet TACCAAAAGAGATCGGCGGGTGCTGCAGCCTCACTGTGTTC
altered cDNA sequence snippet TACCAAAAGAGATCGGCGGGGGCTGCAGCCTCACTGTGTTC
wildtype AA sequence MFHCIPLWRC NRHVESIDKR HCSLVYVPEE IYRYARSLEE LLLDANQLRE LPEQFFQLVK
LRKLGLSDNE IQRLPPEIAN FMQLVELDVS RNEIPEIPES ISFCKALQVA DFSGNPLTRL
PESFPELQNL TCLSVNDISL QSLPENIGNL YNLASLELRE NLLTYLPDSL TQLRRLEELD
LGNNEIYNLP ESIGALLHLK DLWLDGNQLS ELPQEIGNLK NLLCLDVSEN RLERLPEEIS
GLTSLTDLVI SQNLLETIPD GIGKLKKLSI LKVDQNRLTQ LPEAVGECES LTELVLTENQ
LLTLPKSIGK LKKLSNLNAD RNKLVSLPKE IGGCCSLTVF CVRDNRLTRI PAEVSQATEL
HVLDVAGNRL LHLPLSLTAL KLKALWLSDN QSQPLLTFQT DTDYTTGEKI LTCVLLPQLP
SEPTCQENLP RCGALENLVN DVSDEAWNER AVNRVSAIRF VEDEKDEEDN ETRTLLRRAT
PHPGELKHMK KTVENLRNDM NAAKGLDSNK NEVNHAIDRV TTSV*
mutated AA sequence MFHCIPLWRC NRHVESIDKR HCSLVYVPEE IYRYARSLEE LLLDANQLRE LPEQFFQLVK
LRKLGLSDNE IQRLPPEIAN FMQLVELDVS RNEIPEIPES ISFCKALQVA DFSGNPLTRL
PESFPELQNL TCLSVNDISL QSLPENIGNL YNLASLELRE NLLTYLPDSL TQLRRLEELD
LGNNEIYNLP ESIGALLHLK DLWLDGNQLS ELPQEIGNLK NLLCLDVSEN RLERLPEEIS
GLTSLTDLVI SQNLLETIPD GIGKLKKLSI LKVDQNRLTQ LPEAVGECES LTELVLTENQ
LLTLPKSIGK LKKLSNLNAD RNKLVSLPKE IGGGCSLTVF CVRDNRLTRI PAEVSQATEL
HVLDVAGNRL LHLPLSLTAL KLKALWLSDN QSQPLLTFQT DTDYTTGEKI LTCVLLPQLP
SEPTCQENLP RCGALENLVN DVSDEAWNER AVNRVSAIRF VEDEKDEEDN ETRTLLRRAT
PHPGELKHMK KTVENLRNDM NAAKGLDSNK NEVNHAIDRV TTSV*
version genome build 37 / Ensembl release 85
speed 0.31 s

for research use only

All positions are in basepairs (bp) if not explicitly stated differently.
AA/aa: amino acid; CDS: coding sequence; mu: mutated; NMD: nonsense-mediated mRNA decay; nt: nucleotide; wt: wildtype; TGP: 1000 Genomes Project
back to results table

Problems