MutationTaster - study a chromosomal position

NEVER press reload or F5 - unless you want to start from the very beginning.
input seems to be ok - now mapping the variant to the different transcripts...
Querying Taster for transcript #2: ENST00000433625
Querying Taster for transcript #3: ENST00000182527
MT speed 0 s - this script 4.033724 s

Results


genesymbolpredpmodelpred_problemf_splicef_known_DMf_pot_DMAA_changesalt_typesnp_idfeatures_at_a_glancefile
TRAM2disease causing0.999999999985428simple_aae1n/a776994347show file
EFHC1disease causing1without_aaen/a776994347show file

Taster files

Yum, tasty mutations...

mutation t@sting

documentation

Alteration 6:52370454C>G_2_ENST00000182527

Prediction

disease causing

Model: simple_aae, prob: 0.999999999985428      (explain)
Summary
  • amino acid sequence changed
  • heterozygous in TGP or ExAC
  • protein features (might be) affected
hyperlink
analysed issue analysis result
name of alteration 6:52370454C>G_2_ENST00000182527
alteration (phys. location) chr6:52370454C>G show variant in all transcripts   IGV
HGNC symbol TRAM2
ExAC LOF metrics LOF: 0.99, misssense: 1.78, synonymous: 0.68
Ensembl transcript ID ENST00000182527
Genbank transcript ID NM_012288
UniProt peptide Q15035
alteration type single base exchange
alteration region CDS
DNA changes c.818G>C
g.71260G>C
AA changes R273P Score: 103
explain score(s)
frameshift no
length of protein normal
known variant Reference ID: rs776994347
databasehomozygous (G/G)heterozygousallele carriers
1000G---
ExAC0522522
regulatory features
nameclass
H3K27ac Histone Histone 3 Lysine 27 Acetylation
H3K36me3 Histone Histone 3 Lysine 36 Tri-Methylation
H3K4me1 Histone Histone 3 Lysine 4 Mono-Methylation
multicell regulatory features N/A
external features from FANTOM5 and/or VISTA N/A
miRNA binding site(s) N/A
phyloP / phastCons
PhyloPPhastCons
(flanking)-1.2820
6.061
(flanking)6.061
explain score(s) and/or inspect your position(s) in in UCSC Genome Browser
splice sites no abrogation of potential splice sites
distance from splice site N/A
Kozak consensus sequence altered? no
conservation
protein level for non-synonymous changes
speciesmatchgeneaaalignment
Human      273LAVLAIGFGLARMENQAFDPEKGN
mutated  not conserved    273LAVLAIGFGLAPMENQAFDPEKG
Ptroglodytes  all identical  ENSPTRG00000040958  273LAVLAIGFGLARMENQAFDPEKG
Mmulatta  all identical  ENSMMUG00000013718  273LAVLAIGFGLARMENQAFDPEKG
Fcatus  all identical  ENSFCAG00000002975  236LAVLAIGFGLARIENQ
Mmusculus  all identical  ENSMUSG00000041779  273LAVLTIGFGLARVENQVFDPEKG
Ggallus  all identical  ENSGALG00000016673  269LYILVIGFGLPRVENQALEPEKG
Trubripes  all identical  ENSTRUG00000007487  273LMFLAVGFGLARAENPGLDIEAG
Drerio  all identical  ENSDARG00000030092  273LMFLAVGFGLARSENQTLDLETG
Dmelanogaster  not conserved  FBgn0040340  287IGVLTLYYGIGGVRS--------
Celegans  all conserved  WBGene00007696  289IAVMTFWYGLRQAESPFVDISAG
Xtropicalis  all identical  ENSXETG00000000663  272LTVLTVGFGLARAEIHTFNPDKG
protein features
start (aa)end (aa)featuredetails 
112321DOMAINTLC.lost
AA sequence altered yes
position of stopcodon in wt / mu CDS 1113 / 1113
position (AA) of stopcodon in wt / mu AA sequence 371 / 371
position of stopcodon in wt / mu cDNA 1113 / 1113
poly(A) signal N/A
position of start ATG in wt / mu cDNA 1 / 1
chromosome 6
strand -1
last intron/exon boundary 1039
theoretical NMD boundary in CDS 988
length of CDS 1113
coding sequence (CDS) position 818
cDNA position
(for ins/del: last normal base / first normal base)
818
gDNA position
(for ins/del: last normal base / first normal base)
71260
chromosomal position
(for ins/del: last normal base / first normal base)
52370454
original gDNA sequence snippet CATTGGCTTTGGACTGGCTCGCATGGAAAACCAGGCATTTG
altered gDNA sequence snippet CATTGGCTTTGGACTGGCTCCCATGGAAAACCAGGCATTTG
original cDNA sequence snippet CATTGGCTTTGGACTGGCTCGCATGGAAAACCAGGCATTTG
altered cDNA sequence snippet CATTGGCTTTGGACTGGCTCCCATGGAAAACCAGGCATTTG
wildtype AA sequence MAFRRRTKSY PLFSQEFVIH NHADIGFCLV LCVLIGLMFE VTAKTAFLFI LPQYNISVPT
ADSETVHYHY GPKDLVTILF YIFITIILHA VVQEYILDKI SKRLHLSKVK HSKFNESGQL
VVFHFTSVIW CFYVVVTEGY LTNPRSLWED YPHVHLPFQV KFFYLCQLAY WLHALPELYF
QKVRKEEIPR QLQYICLYLV HIAGAYLLNL SRLGLILLLL QYSTEFLFHT ARLFYFADEN
NEKLFSAWAA VFGVTRLFIL TLAVLAIGFG LARMENQAFD PEKGNFNTLF CRLCVLLLVC
AAQAWLMWRF IHSQLRHWRE YWNEQSAKRR VPATPRLPAR LIKRESGYHE NGVVKAENGT
SPRTKKLKSP *
mutated AA sequence MAFRRRTKSY PLFSQEFVIH NHADIGFCLV LCVLIGLMFE VTAKTAFLFI LPQYNISVPT
ADSETVHYHY GPKDLVTILF YIFITIILHA VVQEYILDKI SKRLHLSKVK HSKFNESGQL
VVFHFTSVIW CFYVVVTEGY LTNPRSLWED YPHVHLPFQV KFFYLCQLAY WLHALPELYF
QKVRKEEIPR QLQYICLYLV HIAGAYLLNL SRLGLILLLL QYSTEFLFHT ARLFYFADEN
NEKLFSAWAA VFGVTRLFIL TLAVLAIGFG LAPMENQAFD PEKGNFNTLF CRLCVLLLVC
AAQAWLMWRF IHSQLRHWRE YWNEQSAKRR VPATPRLPAR LIKRESGYHE NGVVKAENGT
SPRTKKLKSP *
version genome build 37 / Ensembl release 85
speed 0.33 s

for research use only

All positions are in basepairs (bp) if not explicitly stated differently.
AA/aa: amino acid; CDS: coding sequence; mu: mutated; NMD: nonsense-mediated mRNA decay; nt: nucleotide; wt: wildtype; TGP: 1000 Genomes Project
back to results table
Yum, tasty mutations...

mutation t@sting

documentation

Alteration 6:52370454C>G_1_ENST00000433625

Prediction

disease causing

Model: without_aae, prob: 1      (explain)
Summary
  • heterozygous in TGP or ExAC
hyperlink
analysed issue analysis result
name of alteration 6:52370454C>G_1_ENST00000433625
alteration (phys. location) chr6:52370454C>G show variant in all transcripts   IGV
HGNC symbol EFHC1
ExAC LOF metrics LOF: 0.00, misssense: -0.80, synonymous: 1.23
Ensembl transcript ID ENST00000433625
Genbank transcript ID
UniProt peptide N/A
alteration type single base exchange
alteration region intron
DNA changes c.1578+15306C>G
g.85349C>G
AA changes N/A
frameshift no
length of protein N/A
known variant Reference ID: rs776994347
databasehomozygous (G/G)heterozygousallele carriers
1000G---
ExAC0522522
regulatory features
nameclass
H3K27ac Histone Histone 3 Lysine 27 Acetylation
H3K36me3 Histone Histone 3 Lysine 36 Tri-Methylation
H3K4me1 Histone Histone 3 Lysine 4 Mono-Methylation
multicell regulatory features N/A
external features from FANTOM5 and/or VISTA N/A
miRNA binding site(s) N/A
phyloP / phastCons
PhyloPPhastCons
(flanking)-1.2820
6.061
(flanking)6.061
explain score(s) and/or inspect your position(s) in in UCSC Genome Browser
splice sites no abrogation of potential splice sites
distance from splice site N/A
Kozak consensus sequence altered? N/A
conservation
protein level for non-synonymous changes
N/A
protein features N/A
AA sequence altered N/A
position of stopcodon in wt / mu CDS N/A
position (AA) of stopcodon in wt / mu AA sequence N/A
position of stopcodon in wt / mu cDNA N/A
poly(A) signal N/A
position of start ATG in wt / mu cDNA 232 / 232
chromosome 6
strand 1
last intron/exon boundary 1809
theoretical NMD boundary in CDS 1527
length of CDS 1653
coding sequence (CDS) position N/A
cDNA position
(for ins/del: last normal base / first normal base)
N/A
gDNA position
(for ins/del: last normal base / first normal base)
85349
chromosomal position
(for ins/del: last normal base / first normal base)
52370454
original gDNA sequence snippet CAAATGCCTGGTTTTCCATGCGAGCCAGTCCAAAGCCAATG
altered gDNA sequence snippet CAAATGCCTGGTTTTCCATGGGAGCCAGTCCAAAGCCAATG
original cDNA sequence snippet N/A
altered cDNA sequence snippet N/A
wildtype AA sequence MSWPVLKFDA YFQEDVPMST EEQYRIRQVN IYYYLEDDSM SVIEPVVENS GILQGKLIKR
QRLAKNDRGD HYHWKDLNRG INITIYGKTF RVVDCDQFTQ VFLESQGIEL NPPEKMALDP
YTELRKQPLR KYVTPSDFDQ LKQFLTFDKQ VLRFYAIWDD TDSMYGECRT YIIHYYLMDD
TVEIREVHER NDGRDPFPLL MNRQRVPKVL VENAKNFPQC VLEISDQEVL EWYTAKDFIV
GKSLTILGRT FFIYDCDPFT RRYYKEKFGI TDLPRIDVSK REPPPVKQEL PPYNGFGLVE
DSAQNCFALI PKAPKKDVIK MLVNDNKVLR YLAVLESPIP EDKDRRFVFS YFLATDMISI
FEPPVRNSGI IGGKYLGRTK VVKPYSTVDN PVYYGPSDFF IGAVIEVFGH RFIILDTDEY
VLKYMESNAA QYSPEALASI QNHVRKREAP APEAESKQTE KDPGVQELEA LIDTIQKQLK
DHSCKDNIRE AFQIYDKEAS GYVDRDMFFK ICESLNVPVD DSLVKEVTCK RLLLPAFTFP
SPVWIPLCGL *
mutated AA sequence N/A
version genome build 37 / Ensembl release 85
speed 0.03 s

for research use only

All positions are in basepairs (bp) if not explicitly stated differently.
AA/aa: amino acid; CDS: coding sequence; mu: mutated; NMD: nonsense-mediated mRNA decay; nt: nucleotide; wt: wildtype; TGP: 1000 Genomes Project
back to results table

Problems